Imagination and Causality in Quantum Physics

[Dragonfly]

It is hard for a layman like me to specify one for an emergence experiment. My gut tells me to suggest a simple archaebacteria, which appears to have the greatest diversity for things like nutrition, is asexual and is suited to extreme environments. To someone like me, that seems to make it easier. The idea is to put together a righteous mix of oxygen, hydrogen, carbon dioxide, sulfur, sulfide and other elements to taste. Pepper it with some choice subparticles to form a membrane. Then zap the little sucker and make it come alive.

The problem is that you really have no idea of the difficulties. As soon as I mention some technical details, your reaction boils down to: don't bother me, don't bother me, don't bother me with technical details. Well, I'm going to bother you again with some details, as that's the only way to get the message through. I'm a layman too when it concerncs bacteria, so I've just with google looked for a page with bacterial genomes and found this one. I just took the first complete one in the list, the Acidithiobacillus ferrooxidans ATCC 23270. You find its DNA sequence here. Just look at all the pages by clicking on the >> symbol (don't cheat!). Now at the left of the screen you see "show as FASTA". Look at this Wikipedia article about the FASTA code. Scroll down to the paragraph "Sequence representation" with the table for the "Nucleic Acid Code". There you see the letters A = Adenosine, C = Cytidine, G = Guanine and T = Thymidine. Click on each of these words to see the molecule they represent. Now go back to all those pages with letters and keep in mind that each letter represents one of these molecules. So perhaps you now may realize what you're asking when you say that we should be able to put something like that together from scratch, starting with elements and simple molecules. And this is only the DNA, not the complete bacterium. It isn't surprising that it took evolution billions of years to arrive at even such "simple" life forms like bacteria. Do you realize now how completely unreasonable it is to demand that we just do the same trick in the laboratory? It is already a fantastic feat that we've succeeded in analyzing such structures, and also that we know a lot about how these things work. For a simple introduction read the chapter about the genetic code in Hofstadter's Metamagical Themes (a fascinating book with among other things a chapter "Pattern, Poetry and Power in the Music of Frédéric Chopin"), it's written for the layman, so there is no excuse not to read it.

Now the question how such bacteria have evolved is the domain of evolution theory. As I've mentioned in an earlier post, the difficulty is that there are probably no recognizable fossil remains of the earliest stages of life on earth, so it's difficult to prove what the exact sequence of events has been. But there is little doubt that the same mechanism of random changes combined with natural selection has worked before the DNA-epoch on simpler self-replicating molecules. As I said in an earlier post: read Dawkins' books for a short description of some of these theories. We may be uncertain about the details, but there isn't any evidence that the standard theories of physics, chemistry and biology are not sufficient to explain the genesis and evolution of life. Saying that the scientific consensus is merely speculation without even having read the simplest description of the relevant theory is inexcusable. "Infusing carbon atoms with life" is not science.

[Michael Stuart Kelly]

Dragonfly,

I'm not going to buy the fogging-over argument that because one thing is complicated to analyze, this disproves another. You simply asked me to be specific and I was. (btw - Fascinating links, but still, I don't need to read a telephone directory to know that there are many different people in a city.)

btw - I found this kind of literature from one of your links to be extremely enlightening:

NCCTGACTAGCTCCTTAGTCCCACACCCGGTATTTATTTATCGCATACTCAAAAGCCTCGGTTACGCCCCCTTCCGAATG

TCTGTCTGGACTATTTTCTCCCCAACATTGATCGTCATATCAACAATATCCTTGTCCGTCAGCTTCGAGCCATCATATGG

TGCATTGGCATTTGACTGGTCCCATGCATGCGACCCTGCCACGTTTGCGGGCTGGCCGTGGCAAACCCCGAACAACAGTC

TTCAACGATTAATGCGCTCAAGCAACGCGGCGATTGGGATTCGAACTCCGCGCTCCAGACAAACTTGGACATCGTCGCTA

TCCGGGAGCGACTGTGAGAATATGGTTAGACGCCGCTCCGATAGAATGGATACCCAACCAGGATCCCGCTTGGATCAATT

AGTGATACAATCGTGGGACCAAGCCAGAGCGGTTCGCATCCATCAGGTGCCTTAACAATGGGACAGGTAGCTTACTACTC

CGTTTTATATTCGTGGCGGACCCTTTTCCGGAACGAACAAATTGAATGTGGGCGTACGTATTCTTTCTTGTCATCAAGAG

ATGGGCGCGTTCCTAATTTGCGGGACAAATTCTCTGGAAGGTTTTTGGATTTTACATTCCTCTAAGCGAACAATTTAATG

TAATTAATGGCCCCTTTTCTAGTCCTTATCTCCGGCATTTCTTTGATACCAGCTTGGTATGTCACCTGGTATAATGACAA

CTTTTTATAGTGTTGCCTTTTCATAGTCTTTGGTGGTCGTGGTAATAAGACTCTATTTCGTGTAACCCAAATGTTAGGTT

TTCCTACCTATTTCTGTGTTAAGAAAAGGCTTTCTCTGTTGATCTATTGGCGCCACATATCATATTTCTCCTTCTTCG

I can't wait to read more...

The point that keeps getting talked around is not that I am demanding anything. For some strange reason you keep saying I am demanding something. Who and what demands it is called burden of proof when you call a hypothesis nonsense. My problem is that you support an unfounded statement - a wholesale dismissal of other hypotheses. Since I haven't read the works you mentioned, I must look to the opinions of the people Christian keeps posting right now (and others), who apparently have read those works.

Let me be clear, because you keep misunderstanding something. You use phrases like:

Saying that the scientific consensus is merely speculation...

I never say that. Come on. I merely point out (in different words up to now) that one school of scientific consensus (yours) is speculation when it dismisses a hypothesis wholesale because there are opposing schools of scientific consensus that support it (ones mentioned by Christian, for example). And this concerns one point only - not the whole field of science.

I really don't need to read a lot of technical literature to see that highly qualified technical people disagree with each other. (Although I am putting some of this on my "to read" list. Thanks for the indications.) I just happen to lean in the direction of the others right now, but I am not against being convinced if I am wrong. You have to do better than ignore or fog over the question in order to convince me. That means refuting those other dudes and they seem to be resisting mightily. (I am a mere layman in genetic science, so refuting me scientifically is actually "trivial," to coin a phrase.)

Call it philosophy. Or common sense.

Incidentally I have a question. Do you consider the science of biology nothing more than the study of the results of physics and chemistry? (This is a serious question.)

Michael

[Dragonfly]

I'm not going to buy the fogging-over argument that because one thing is complicated to analyze, this disproves another. You simply asked me to be specific and I was.

Huh? What are you talking about? I asked what you meant by "emergence". You then specify it as "emergence of a life from non-living matter". In a previous post you wrote:

Science simply can't do it the two things I mentioned: (1) give a start to life from non-living elements, and (2) revive the dead.

That makes the claim that life is ONLY "a very complex series of controlled chemical reactions" too all-inclusive right now as it discards the possibility that life might be a special form of existence (which I think it is)

So your claim is that the fact that science can't create life from non-living elements is an argument against the claim that life is only a very complex series of controlled chemical reactions. Then you describe some imaginary experiment in which a few elements are mixed and voilà, there is a bacterium. It's obvious that you don't for one moment believe that you could get a bacterium that way, and that your point is that this proves that science can't do it and that this is an argument against the reducibility of life. This is of course a non sequitur. To know how something works does not imply that we should be able to make that something. We know the structure of the sun, where it gets it energy, how it has been in the past and how it will develop in the future and when it will become a red giant, ending all life on earth. The fact that we can't make a sun does not imply that our theory is incomplete (it may be incomplete in the details, but not in the essence) and that something "more" is necessary to explain the behavior of the sun, while it is an "existent" (whatever that may be).

(btw - Fascinating links, but still, I don't need to read a telephone directory to know that there are many different people in a city.)

It's obvious you did not know how many people live in this city, otherwise you wouldn't have come up with that ridiculous experiment.

btw - I found this kind of literature from one of your links to be extremely enlightening:

Apparently it hasn't been enlightening enough.

The point that keeps getting talked around is not that I am demanding anything. For some strange reason you keep saying I am demanding something.

Yes, you are demanding something. You are demanding that scientists should be able to create life from inanimate matter as otherwise life can't be reducible in your opinion. As I've shown this is a completely unreasonable demand and as an argument it is worthless.

Who and what demands it is called burden of proof when you call a hypothesis nonsense. My problem is that you support an unfounded statement - a wholesale dismissal of other hypotheses.

I support the scientific consensus, in biology there are no serious other hypotheses about life, this is the backbone of the whole science of biology. Other hypotheses are for confused amateurs.

Since I haven't read the works you mentioned, I must look to the opinions of the people Christian keeps posting right now (and others), who apparently have read those works.

What works? I've seen only some ramblings about consciousness by Velmans, a psychologist, nothing about the reducibility of "life".

I never say that. Come on. I merely point out (in different words up to now) that one school of scientific consensus (yours) is speculation when it dismisses a hypothesis wholesale because there are opposing schools of scientific consensus that support it (ones mentioned by Christian, for example). And this concerns one point only - not the whole field of science.

Opposing schools of scientific consensus? I haven't seen them. You don't really think that Velmans represents an opposing school? He isn't even a biologist and in the quotes I've read I haven't seen any argument or even statement about the reducibility of life. Those opposing schools exist only in your imagination.

I really don't need to read a lot of technical literature to see that highly qualified technical people disagree with each other.

No, they do not. At least not about the fundaments of biology and life, of course they may disagree a lot about the details of their field, but every biologist who does real scientific work accepts the fact that life in principle can be understood in terms of the current scientific knowledge.

Incidentally I have a question. Do you consider the science of biology nothing more than the study of the results of physics and chemistry? (This is a serious question.)

No, the science of biology is reducible to chemistry and physics, just as the science of chemistry is reducible to physics, that is the essence of reductionism, but chemistry and biology each have their own methods that fit their object of study, they don't use quantumchromodynamics in their theories, that would be an example of greedy reductionism. In fact you could consider all those sciences as physics, but with specializations, the lowest level of which we now call ("proper") physics, the next level chemistry and the then next level biology. Of course there isn't a sharp division between the fields, the boundary fields are in fact disciplines in themselves (like physical chemistry, molecular biology, biochemistry).

[Dragonfly]

I started to quip, Surely you're joking, Mr. FlyMan. But I don't think you were asking the question in jest, since you continued with a serious-sounding explication. So I'll try this to see if it succeeds at getting through the point I'm making about the experience not being identical to the physiological activity. You've said that you play the piano, so I'll substitute in your question above: If you play a sonata, is the music on the printed score or in your fingers?

You may call the score "music", and the sounds in the room "music", but the experience of music is in your brain (that is one meaning of "experience", you don't like it, but I think it is valid, I'd call it the objective experience), and while you may "experience" (in the second meaning of the word, the subjective experience) the sounds as being in the room, I'm not sure that you don't even subjectively experience the music at least partly as something "in your head", just as your experience of reading a novel is more in your head than in the letters on the paper. Well, that is at least my experience.

[Michael Stuart Kelly]

Dragonfly,

You still don't get it, but you do look cute when you get mad...

I do not claim that "life" is not reducible to biological, chemical and physical elements. Of course it is. Open your head - put the idea that I agree with that in it, close it, lock it and throw away the key. It gets tedious correcting the same misrepresentation all the time.

I claim that it has not been proven that "life" is reducible SOLELY to those disciplines (but defining biology according to your manner). This leads to the validity of postulating and testing other hypotheses until it can be proven.

I simply don't see how saying that you don't know how life emerged in reductionist terms leads to the fact that there are not - and cannot ever be - any other elements to consider. I find that statement flawed and misleading because of the lack of proof.

(sigh)

Am I really going to have to look up other scientists and schools of thought on this because you claim that those who do not agree with you are not "serious"? btw - You are right about Velmans being a psychologist - I need to reread Christians posts again to see where I got the implications I am talking about. I will do all this if necessary, but I have other things to write at the moment.

I suggest we take a small break so we can catch up on other stuff. (I do like seeing you all mad and cute and everything, though...)

Michael

[Dragonfly]

I claim that it has not been proven that "life" is reducible SOLELY to those disciplines (but defining biology according to your manner). This leads to the validity of postulating and testing other hypotheses until it can be proven.

This shows that you don't understand how science works. It is not the task of science to disprove all possible hypotheses, that would be impossible. For example, you never can prove that "God did it" is an incorrect hypothesis; in the same way you never can prove that a hypothesis "there is something more" (which in fact is equally vague and untestable as the God-hypothesis) is incorrect. What science does is to construct models of reality and test these. You can never prove that your model is correct, but you can collect enough evidence to accept that model as a good model until there is evidence that the model is not correct. Well, in this case there isn't a shred of evidence that the model is not correct but there are libraries full of evidence that confirm the reductionist model. We don't have to disprove "other" models, it is up to those who claim that their model is better than the commonly accepted one to show that their model makes different predictions than the standard model and that these predictions are in accordance with the experimental evidence, in other words, they should be able to falsify the current model and show that their own model gives a better fit to the data. Vague mumblings of "I think there must be more" are no serious argument, just as the God hypothesis is no serious argument, in fact there is no essential difference between these two arguments.

(sigh)

You should hear the volume of the sighs here. If a few hurricanes hit your home tomorrow you'll know where they come from.

[Michael Stuart Kelly]

Dragonfly,

I already feel winds blowing....

This shows that you don't understand how science works.

Of course I know how science works. I also know that the ones who are the prime movers pf progress are those who think outside the box - not those who continually claim that something is preposterous, it can't be done, etc.

I find something so breathtaking (sigh-taking, maybe) in the juxtaposition of two phrases you just wrote, one right after the other:

1. For example, you never can prove that "God did it" is an incorrect hypothesis; in the same way you never can prove that a hypothesis "there is something more" (which in fact is equally vague and untestable as the God-hypothesis) is incorrect.

2. What science does is to construct models of reality and test these.

Setting aside the strange notion that a hypothesis for discovering the nature of an element cannot be tested at all ("untestable" is your word), don't you see anything clashing between these two statements? I hear a veritable gong with Heavy Metal-type amplification.

Michael

[reason.on]

Opposing schools of scientific consensus? I haven't seen them.

http://www.kmbook.com/science.htm

Science As Consensus According to this approach, scientific knowledge is the product of a collective human enterprise to which scientists make individual contributions which are purified and extended by mutual criticism and intellectual cooperation. According to this theory the goal of science is a consensus of rational opinion over the widest possible field (Ziman, 1967). The two concepts of consensibility and consensuality need to be differentiated for understanding of this goal.

Scientific knowledge is distinguished from other intellectual artefacts of human society by the fact that its contents are consensible. This implies that each message should not be so obscure or ambiguous that the recipient is unable either to give it whole-hearted assent or to offer well-founded objections. The goal of science, moreover, is to achieve the maximum degree of consensuality. Ideally the general body of scientific knowledge should consist of facts and principles that are firmly established and accepted without serious doubt, by an overwhelming majority of competent, well-informed scientists. A consensible message is one which has the potentiality for eventually contributing to a consensus, and a consensual statement is one which has been fully tested and is universally agreed. We may say, indeed, that consensibility is a necessary condition for any scientific communication, whereas only a small proportion of the whole body of science is undeniably consensual at a given moment (Ziman, 1978)

Whereas philosophers located the source of the consensual character of science in the scientist's adherence to the canons of a logic of scientific inference, sociologists argued that science exhibited so high a degree of agreement because scientists shared a set of norms or standards which governed the professional life of the scientific community. Based upon the consensual view of science, science was thought to be strictly cumulative (Laudan, 1984). The opposing view of science is that of dissension.

Science As Dissension

There are four lines of argument which undermine the classical preoccupation with scientific consensus: the discovery that scientific research is much more controversy-laden than the older view would lead one to expect; the thesis of theory incommensurability; the thesis of the underdetermination of theories; and the phenomenon of successful counternormal behavior (Laudan, 1984).

The ubiquity of controversy is succinctly captured by Kuhn (1977) in his objection to the consensual approach: the emergence of new scientific ideas "requires a decision process which permits rational men to disagree, and such disagreement would generally be barred by the shared algorithm which philosophers have generally sought. If it were at hand, all conforming scientists would make the same decision at the same time." Kuhn maintains that it is only the existence of differential preferences and values among scientists which allows new theories to flower. What makes the broad degree of agreement in science even more perplexing is the fact that the theories around which consensus forms do themselves rapidly come and go (Laudan, 1984).

The thesis of incommensurability implies that rival theories are radically incommensurable. The impossibility of full translation between rival paradigms is further exacerbated by the fact that the advocates of different paradigms often subscribe to different methodological standards and have nonidentical sets of cognitive values (Kuhn, 1977).

The underdetermination of data amounts to the claim that the rules or evaluative criteria of science do not pick out one theory uniquely or unambiguously to the exclusion of all its competitors. Feyerabend (1978) and Mittroff (1974) have both argued that many highly successful scientists have repeatedly violated the norms or canons usually called scientific. Specifically, Feyerabend believed that it is undesirable for scientists to ever reach consensus about anything. His ideal of science is the sort of endless questioning of fundamentals which one associates with pre-Socratic natural philosophy: nothing is taken as given, everything can reasonably be denied or affirmed. Indeed, many of the most noteworthy instances of scientific progress seem to have involved scientists who have repeatedly violated the norms or canons usually called scientific. For the supporters of this doctrine, scientific debate and disagreement is far more likely the "natural" state of science than consensus is (Laudan, 1984).

RCR

[Dragonfly]

Of course I know how science works. I also know that the ones who are the prime movers pf progress are those who think outside the box - not those who continually claim that something is preposterous, it can't be done, etc.

And who is saying here that "it can't be done"? Do you ever look in the mirror?

Setting aside the strange notion that a hypothesis for discovering the nature of an element cannot be tested at all ("untestable" is your word), don't you see anything clashing between these two statements? I hear a veritable gong with Heavy Metal-type amplification.

There is no clash, you can test scientific theories which make predictions by comparing those with the experimental evidence, but how do you test those vague statements?

[Dragonfly]

Opposing schools of scientific consensus? I haven't seen them.

http://www.kmbook.com/science.htm

Irrelevant. You're ignoring the context of my remark, which was the consensus among biologists about the fundamental theory of life, not scientific theories in general.

[Michael Stuart Kelly]

Dragonfly,

Not even close. No cigar.

And who is saying here that "it can't be done"? Do you ever look in the mirror?

Please read my posts correctly. There is a world of difference between "it can't be done" (ever) and ""it hasn't been done." I just looked and saw the permanent "can't be done" idea creep in during a previous statement:

So your claim is that the fact that science can't create life from non-living elements is an argument...

I thought you understood this in the sense I always do, implying "it can't be done as of now, but possibly could be done in the future."

... how do you test those vague statements?

You start by wanting to. Then you isolate an aspect of the "vague idea" for study and decide on a specific point that appears to be true or plausible. You set up controls and a procedure to find out if results can be predicted or countered based on that point. Then you execute a series of tests and actions as per the controls and procedure. You record the results and, at the end, draw up a conclusion. Then usually you share all this with others in some form or another.

I thought you knew that, but since you did ask...

(The clashing is louder than the hurricane right now...)

Michael

[Dragonfly]

So your claim is that the fact that science can't create life from non-living elements is an argument...

I thought you understood this in the sense I always do, implying "it can't be done as of now, but possibly could be done in the future."

That is not relevant. Your repeatedly came up with the argument "there must be more, otherwise those scientists should be able to make life in their laboratory." That argument is just wrong.

... how do you test those vague statements?

You start by wanting to. Then you isolate an aspect of the "vague idea" for study and decide on a specific point that appears to be true or plausible. You set up controls and a procedure to find out if results can be predicted or countered based on that point. Then you execute a series of tests and actions as per the controls and procedure. You record the results and, at the end, draw up a conclusion. Then usually you share all this with others in some form or another.

Fine. And has anyone done that with your notion that there must be more in life than our current theory?

What is that noise? A thunderous silence?

I think I'll light another cigar.

[Michael Stuart Kelly]

That argument is just wrong.

Why?

Edit - Sorry. I read too fast. The idea you expressed is wrong. I agree. Unfortunately it has nothing at all to do with what I have written or have argued.

Michael

[Ellen Stuttle]

Dragonfly is right! In posts # 185 - # 187, he is right. I think you will find his perspective completely consistent.

I do not find his perspective completely consistent. Although I find his explanations in posts 185 (pertaining to electric currents and magnetic fields) and 186 (pertaining to the evolution of living entities from non-living entities) admirably clear (as his explanations characteristically are when he's writing about issues which neatly fall within the purview of physics), I find his presentation in post 187, as with the posts in which he discussed pain, muddled and the perspective from which he's theorizing not consistent.

Here are four overarching problems from which I think that perspective suffers:

(1) It eliminates rather than properly explaining the phenomena of sensory awareness it purports to explain, in that it alternately equates our sensory experience with brain activity (declaring an identity between what we experience and brain activity) and holds that we just "think" (ambiguity piled upon ambiguity in the circumstances) we experience what we do experience.

(2) It resorts to a mechanism -- "projection" -- which amounts to saying "somehow" in scientific-sounding language.

(3) It undercuts scientific investigation at the root, since the enterprise of science rests on what's called "the validity of the senses" and the content of the theory proposed says that our experience of a sensory world is an enormous "illusion" "projected" by our brains.

(4) It leads to a self-refutational difficulty, since knowledge of the existence of the very brain in one's skull which is said to "project" the sensory world can itself only be arrived at via the "illusion" of that world "projected" by that brain. (In the usual case, one's own brain is known to exist by inferential procedures based on observations of other brains -- one doesn't directly experience the physical existence of one's own brain, short of having one's cranium sliced open, in which case, if the injury wasn't fatal, one might be able to see or touch the roundish, spongy object inside one's skull; but even then, according to the theory, the perception of one's own brain would be the perception of an object external to that brain's activity and would itself be an "illusion" "projected" by that brain.)

Ellen

___

[Ellen Stuttle]

And, an incidental issue:

Paul,

A question I've been meaning to ask you: There's a theorist (I think he has an engineering degree, not a physics degree) named Hall (I forget his first name) who proposes a theory with striking similarities to yours. (I warn you, he's considered a "crackpot" by all the physicists I know of who have heard of him, which is a fair number of physicists: Hall pesters physics departments.) I wonder if you've ever heard of him.

Ellen

___

[Ellen Stuttle]

I started to quip, Surely you're joking, Mr. FlyMan. But I don't think you were asking the question in jest, since you continued with a serious-sounding explication. So I'll try this to see if it succeeds at getting through the point I'm making about the experience not being identical to the physiological activity. You've said that you play the piano, so I'll substitute in your question above: If you play a sonata, is the music on the printed score or in your fingers?

[DF]You may call the score "music", and the sounds in the room "music", but the experience of music is in your brain (that is one meaning of "experience", you don't like it, but I think it is valid, I'd call it the objective experience), and while you may "experience" (in the second meaning of the word, the subjective experience) the sounds as being in the room, I'm not sure that you don't even subjectively experience the music at least partly as something "in your head", just as your experience of reading a novel is more in your head than in the letters on the paper. Well, that is at least my experience.

Hastily -- gotta get out'o here, like NOW: We might be making some progress at least on the terminological issue. No, I emphatically do not like "experience" for the neurophysiological occurrences. Maybe this doesn't bother you the way it does me since you're not a native English-speaker. To me, it sounds like a terrible misuse of the English language. However, your indication of using a different adjective for the respective "experiences," viz., "objective" and "subjective," is helpful to assisting communication and getting around some of the ambiguity. I wonder if instead of "experience" you'd be willing to adopt -- for the sake of our particular exchange -- the usage "objective frame of reference" and "subjective frame of reference." Dennis May and I use that terminology and find it aids our understanding each other -- and helps in making the differences of opinion clearer.

Ellen

PS: Please see my post two above where I listed what I find as the consistency problems with your thesis.

___

[Paul Mawdsley]

And, an incidental issue:

Paul,

A question I've been meaning to ask you: There's a theorist (I think he has an engineering degree, not a physics degree) named Hall (I forget his first name) who proposes a theory with striking similarities to yours. (I warn you, he's considered a "crackpot" by all the physicists I know of who have heard of him, which is a fair number of physicists: Hall pesters physics departments.) I wonder if you've ever heard of him.

Sorry Ellen, I haven't. I'm an authentic, first-hand crackpot in my own right. I have found the beginnings of my notion of causality in Rand and Branden; I've gathered the base of my physics primarily from Asimov's Understanding Physics series and Penrose, with a few others peppered in there; I have looked outside of the box with Bohm and Alfven (via Lerner) in physics, Arp in astronomy, and Wesson in evolution theory; I have a specialized psychology degree with one credit shy of having a philosophy minor (the only 4th year subject I wanted to take was Philosophy of Science, and I couldn't stand the professor); and I would describe myself more as being an artisan, with a trades background, who has tried to educate himself by translating the language of philosophy and science into the language of intuition. Much of what I write is my own twisted creation in an attempt to integrate all the evidence and information I can find into a unified visual model of existence. One of my biggest struggles is putting words to the images I have created. I think you understand this issue as you have commented a couple of times on OL about how you sometimes process images so quickly (while "brainstorming"), you cannot capture them in words. One of my primary reasons for writing on OL is to work on putting words to the models I have built in images. What I have come to realize in these discussions is that modern physics has eliminated my particular mode of processing and explaining the world as a valid means to knowledge about the physical universe because it is claimed that the foundations of reality cannot be visualized. So I would like to show that modern physics (symbolized by Dragonfly) is mistaken on this point. If I can begin to do this, I would then like to talk about how a new concept of causation, proactive causation, can act as a guiding principle to shape a visual model of the physical universe while giving a causal account of all the evidence, theories, and laws that make up modern physics.

btw- thanks for the name of that other crackpot. I'll see if I can look him up.

Paul

[Paul Mawdsley]

Dragonfly is right! In posts # 185 - # 187, he is right. I think you will find his perspective completely consistent.

I do not find his perspective completely consistent. Although I find his explanations in posts 185 (pertaining to electric currents and magnetic fields) and 186 (pertaining to the evolution of living entities from non-living entities) admirably clear (as his explanations characteristically are when he's writing about issues which neatly fall within the purview of physics), I find his presentation in post 187, as with the posts in which he discussed pain, muddled and the perspective from which he's theorizing not consistent.

Ellen,

I agree with you. I meant to say, "His perspective on physics is completely consistent," in the same way Bohr's was. His thinking exists within the language of applied mathematics. If you are going to disagree with Dragonfly, you have to step out of the epistemological context of modern physics. This is what you are doing. You are talking about visualization connected by logic. This is a completely different language. Dragonfly's perspective is only muddled and inconsistent if we assume 'qualia' to be real and causally connected to the actions of the brain. If qualia is an illusion, or if it is just an epiphenomenal event associated with neural activity, Dragonfly is being consistent. An experience is caused by the actions and interactions of things in the world, which effect things in our body we call senses, which effect the actions of our brains. But the experience is contained in the brain.

If it sounds like I am supporting this perspective, I am not. I am attempting to recreate it so I can understand it. I assume qualia to be the basic elements of our perceptions and, once isolated via the focus of our awareness, they are the fundamental building blocks of all we create in our imagination. These qualia do have a reciprocally causal effect on the brain: they are caused by the firing of neural networks; and they cause the firing of neural networks (perhaps a use for Penrose's tubules). Relating back to things I have mentioned previously, qualia would exist as distinct wavelengths of ripples in the stream of awareness.

Since I see the nature of experience (and creative self-assertion) to be fundamentally connected to qualia, I cannot agree with Dragonfly's view. As I jokingly said this morning, the physics of experience would have to be mathematically described as a complete system whereby the object of perception, the medium through which the information travels, and the thing that perceives, act as a flowing unit of information in which the sub-quantum scale patterns of fundamental proactive particles affect the behaviour of the classical scale human being by informing the direction of his/her intrinsic motion. This is a fundamentally non-local/nonlinear causal system in which the whole system informs (affects) the actions of one part of the system. (Note: holding alternative sets of information and initiating action toward a particular set adds the element of volition to the process.) Again, this is similar in principle to Bohm's information wave in his causal interpretation of quantum physics. ( I hope these words come close to conveying the images I have.) As a fundamentally non-local/nonlinear system, reductionism, and modern physics, cannot account for it. (Edit for clarity: Reductionism and modern physics cannot account for the interconnected qualitative flow of experience.)

Paul

Edited September 28, 2006 by Paul Mawdsley

[Dragonfly]

Here are four overarching problems from which I think that perspective suffers:

(1) It eliminates rather than properly explaining the phenomena of sensory awareness it purports to explain, in that it alternately equates our sensory experience with brain activity (declaring an identity between what we experience and brain activity) and holds that we just "think" (ambiguity piled upon ambiguity in the circumstances) we experience what we do experience.

(2) It resorts to a mechanism -- "projection" -- which amounts to saying "somehow" in scientific-sounding language.

Well, first I'm no neuropsychologist, so I don't claim that I know all the exact answers (neither do neuropsychologists for that matter), I'm just thinking aloud or brainstorming or whatever you call it. I'll try to elaborate a bit on the points you mention. First, I don't see why that mechanism of "projection" would be so mysterious. It is the result of the way we interact with the physical world. With our eyes and our proprioception we can move effortlessly through a 3-dimensional world. This is no trivial task, however, as the brain receives signals that correlate to a 2-dimensional image on the retina, that changes with every movement we make, and yet we can in real time infer from these changes a 3-dimensional structure. I think that this ability is largely or even completely prewired. There are mammals like certain herd animals that can practically immediately after birth run along with the other animals, so they have no problem in perceiving a 3-dimensional world. We humans are a bit slower, but I don't think that we have to learn to see a 3-dimensional world instead of an "undifferentiated chaos" as Rand claims; this is not really relevant to this discussion, however.

When we move around our position changes and the visual input also changes. To move efficiently we need continually the visual feedback (and that of proprioception, but I'll ignore that here) to direct our movements. So the visual input has our attention and at the same time we construct a 3-dimensional representation that correlates with the real world. We don't even have to move to do that, as we can also use binocular vision to create a 3-d model. Small differences between the images of both eyes are quickly converted to 3-d information. This happens so smoothly and seamlessly that we "immediately" see depth. Why bother with the intermediate steps (measuring differences in distances between one pattern and another one) if we only need the end result? We see a colored pattern and at practically the same time we create a 3-d model that corresponds to that pattern. This is an example of projection or the user illusion; we need a fast feedback system to be able to move around, there is no need for an awareness of the intermediate steps or calculations in our brain - it would just distract us and slow us down and that wouldn't be efficient, just as we as users usually don't bother about all the processes that occur between hitting a key of the keyboard and the appearance of the corresponding letter on the screen. It seems to happen immediately, but in fact there is a complex chain of events between the two actions. When we move around in the world, we have to use the processing power of our brain efficiently, so that we have the time to construct a useful 3-d representation that correlates accurately with the real world. The result is that what we perceive corresponds closely with what happens in the real world, so our subjective experience is not that we're busy processing data in the little box on top of our body, but that we are moving in the real world, that our perception is immediate. That matters are in fact more complicated is apparent when there is some malfuctioning in the system like the patient in Sack's book A Leg to Stand On, who as the result of a tumor in his brain no longer recognized one of his legs as his own and tried to remove it, thinking someone was playing a joke on him (Sacks himself later had a similar though less dramatic experience when one of his legs was injured). In the same book Sacks describes how he experienced a temporary inability to see depth beyond a certain distance; he could observe the different spacings in the visual field (the intermediate results), but could not integrate them into a 3-d representation (the final perception). Another famous example is of course Sacks' man who mistook his wife for a hat. Such pathologies disturb the smooth processing and show something of the underlying processes, of which we're not aware when everything is functioning well.

(3) It undercuts scientific investigation at the root, since the enterprise of science rests on what's called "the validity of the senses" and the content of the theory proposed says that our experience of a sensory world is an enormous "illusion" "projected" by our brains.

Come on Ellen, you can do better than this! This must be a temporary lapse, it sounds like a rehash of the standard randroid argument... Ok, I'll clarify it if you insist. When we talk about the "user illusion", the word "illusion" does not mean that the information about the external world that we receive is incorrect, only that it is an illusion to think that it is a direct experience. This illusion arises while the system in general functions perfectly and seamlessly, so the intermediate steps don't seem to exist (I saw once an amusing illustration of the user illusion in a computer game, when someone was driving a race car on the screen and was bracing himself in difficult situations as if he was driving a real car, which was completely unnecessary, as the only physical interaction was via a joystick; it's interesting that even such an obviously artificial situation can generate such a strong illusion). The system is not perfect, however, it may be malfunctioning, due to pathology or to certain specific circumstances. Now I hope you won't tell me that if it's not perfect it's not valid! The fact that we may err sometimes (for different reasons, not only for incorrect perception) doesn't undercut scientific investigation at all, we need not be infallible to do that very well.

(4) It leads to a self-refutational difficulty, since knowledge of the existence of the very brain in one's skull which is said to "project" the sensory world can itself only be arrived at via the "illusion" of that world "projected" by that brain. (In the usual case, one's own brain is known to exist by inferential procedures based on observations of other brains -- one doesn't directly experience the physical existence of one's own brain, short of having one's cranium sliced open, in which case, if the injury wasn't fatal, one might be able to see or touch the roundish, spongy object inside one's skull; but even then, according to the theory, the perception of one's own brain would be the perception of an object external to that brain's activity and would itself be an "illusion" "projected" by that brain.)

I really don't see how this can be self-refutational, I'm baffled that you seem to see this as a problem, something similar has also been brought up as an argument against determinism (by you or someone else, I'm too lazy to look it up now). Self-referential systems can be fully consistent, even if they are not infallible and they're able to study their own fallibility. You may conclude from that that we don't have absolute certainty about the result, but do you really think that absolute certainty is possible anyway? I think we're better off when we realize that we may err than when we think that we're infallible, as we may correct errors easier when we know that they are possible.

[Ellen Stuttle]

Dragonfly (et al.) --

I expected that Dragonfly would post to my list of four problems that I see with his views with a reply needing considerable attention. I apologize for delaying a response. Something quite unanticipated happened last week, in that I received an emergency request from a long-time friend to assist with an editorial project. At first I backed off, given that my life circumstances are "pressured" in general; but it's a case of "I cannot do otherwise" [??] -- the project "took fire 'in my brain[??]'" and is giving me no rest. I estimate/hope I'll have finished by Tuesday. I daren't read the details of Dragonfly's reply until then, since the interfering "program" [??] of thought patterns re mind/body would mess up the push to meet a severe time deadline on an unrelated project. Again, apologies.

Ellen

__

[Paul Mawdsley]

Paul,

I missed your post that was just before my last one. I am not a scientist, I am an electronics engineer. I love the sciences and engineering.

I'm sorry if I seemed rude with my "because it's a trivial question" reply. You are correct in your later post, it's a matter of different perspectives. I have a very matter of fact point of view about everything and I find discussing semantics tiresome. I like understanding how things work, problem solving, and fixing what's broken. The following post on RoR describes my perspective (which I evidently do not live up to) on philosophical discourse:

http://rebirthofreason.com/Forum/GeneralForum/0789.shtml#0

Mike,

I appreciate this response. I too have a very applied background and "like understanding how things work, problem solving, and fixing what's broken." My applied background just requires the language of a simple but imaginative craftsman rather than the specialized knowledge of engineering. I finally got the time to check out your post on RoR. I like your particular twist on social dynamics. I agree with your statement: "No matter how long it takes people of goodwill and reason and patience should be able to eventually agree." This is true even if along the way they have to agree to disagree.

"Agreeing to disagree" reminds me of something that NB says about personal development. He says that it is often difficult to face certain facts of reality, so we resist them by putting up psychological barriers to being aware of them. Then, in therapy, people refuse to accept that they are resisting certain facts of reality. They resist the resistance. The place where growth begins is in acceptance, even if this is in the acceptance of the resistance to resistance.

If, while in dialogue, another has an opposing perspective, our perspective is experienced as a resistance to the reality of theirs (edited for precision). When we argue we are resisting the resistance. Agreeing to disagree is acceptance of our resistance to the resistance and opens up the possibility of accepting another's contrary view into our awareness where open evaluation can lead to discovery, integration, and growth.

Based on what I read in your RoR post, I think you and I will get along just fine. This attitude about the proper dynamics of dialogue is the standard we do try to reach on OL. We will all slip occasionally. That's when, from one party, empathy and understanding is called for rather than attack; and from the other, reevaluation, self-correction, and sometimes even apology. We both lived up to this.

Paul

Edited September 30, 2006 by Paul Mawdsley

[Paul Mawdsley]

Ellen,

I think this might be who you were referring to: "Donavan Hall is a Ph. D. candidate in condensed matter physics at Louisiana State University. His area of expertise is the measurement of quantum oscillations in strongly correlated materials."

This is the name I came up with by doing a search for "Hall physics crackpot." He seems to fit the bill. I'll have to read some more to see what I think of his perspective. First impressions: his perspective is narrower, less visually evolved, but more evolved in the language of physics than mine. By tying my own view to a reevaluation and reinvention of causation, it applies to a much broader spectrum of phenomena than quantum physics including: volitional consciousness, individual psychological dynamics, social psychological dynamics, and the nature of sub-quantum particles that can give a causal account for the mathematical descriptions of the universe beyond just quantum mechanics: all the unmeasurables. Although I'm much quieter about it, I think this makes me a bigger crackpot.

It is a competition!

Paul

Edited September 30, 2006 by Paul Mawdsley

[Paul Mawdsley]

I made mental note of the fact that Hall also was using the language of theism in an article I skimmed. The following makes this impression very clear.

Embracing Science

Christianity in the Twenty-First Century

This seminar series is an investigation of the interplay and points of contact between natural science and Christianity. The arguments presented are peculiar to Christianity. Although I will touch on theism and religion in general, my central (and most radical) claim is that Christianity is ideally suited to meet the challenges of modern science to faith on Earth. Christians have nothing to fear from natural science; Christianity will not become obsolete if evolution and physicalism are proved correct. The resilience of Christianity lies in the fact that it is not simply a pius, utilitarian belief system good for maintaining the public peace. Christianity makes a bold and superior claim to all other forms of theism--God entered creation and became incarnate. This central fact allows the Christian to boldly embrace the natural sciences. (Donovan Hall)

This is definitely not my language. In my opinion, this is the result of an underdeveloped concept of causation. The causal principles he uses to shape the images in his head are primitive, unfounded in the evidence, and lead his imagination to supernatural distortions of existence. Based on the above quote, I would assess the use of his imagination as epistemologically valid but the causal principles he is using as being very incomplete and unintegrated. A deeper understanding of causality does not lead one to conclude there is such a thing as supernatural existence such as gods, ghosts, or angels on the head of a needle. In fact, it integrates the evidence of reality while simultaneously excluding the supernatural.

Upon reflection, I've changed my mind. He is much more of a crackpot than I. My scope might be broader but my imagination and principles stay within the confines of the evidence. God is alive and well. He just doesn't exist outside of people's imaginations. I am trying to build pictures of a reality that exists independent of, and is the cause of, the mind that is imagining it.

Paul

[Michael Stuart Kelly]

Paul,

Interesting comment:

Upon reflection, I've changed my mind. He is much more of a crackpot than I.

As a causation thing, I wonder where this kind of thinking will lead...

Michael

[Paul Mawdsley]

Paul,

Interesting comment:

Upon reflection, I've changed my mind. He is much more of a crackpot than I.

As a causation thing, I wonder where this kind of thinking will lead...

I only think of myself as a crackpot when I wear the lens of modern physics and try to evaluate what I say.

I'm not really a crackpot.... No, really I'm not...... No, leave me alone!.....There coming to take me away aha, heehee!....Aaaaaaaaahhhhh!

Paul